Last updated: April 21, 2026

How to Run Pre-Order Oligo Pool QC Before Synthesis

Use this page when you need to screen a large oligo pool before submission, decide whether GC spread, Tm variation, homopolymers, or secondary structures are severe enough to trigger redesign, and know which checks belong in a fast pre-order pass versus a deeper workflow. If you already know the next action, open the Batch Sequence QC, Pre-Order Oligo Pool QC Workflow, GC Content Analyzer, Tm Calculator, and What QC Should I Request for Oligos?.

Key Takeaways

  • Industry QC validates 7 critical parameters: GC% (40-60%), Tm uniformity (±5-10°C), length (18-200bp), homopolymers (<4bp runs), ΔG secondary structures (<-3 kcal/mol), sequence complexity, and base composition
  • Synthesis success correlates with QC stringency: 95%+ pass rate indicates optimal pool design for array synthesis
  • NGS library pools require ±2% GC content standard deviation and ±3°C Tm range for uniform amplification
  • Homopolymer runs >4bp cause 60% of synthesis failures; detection before synthesis saves $200-500 per failed pool
  • Batch validation of 10,000 sequences in <2 minutes enables rapid design iteration cycles
  • Pool uniformity coefficient of variation (CV) <15% ensures consistent representation in pooled synthesis
Scientist in a cleanroom examining NGS flow cell and quality control metrics on a tablet

1. Which QC Checks Matter Before Ordering an Oligo Pool?

Quality control for oligonucleotide pools validates sequences before synthesis to prevent experimental failures. Pool QC differs from single-oligo validation by requiring uniform properties across hundreds to thousands of sequences while ensuring synthesis compatibility and experimental reproducibility.

  • Individual sequence quality: Each sequence passes thermodynamic and compositional thresholds
  • Pool uniformity: GC content SD <2%, Tm range <10°C, length variation <20%
  • Synthesis compatibility: No homopolymers >4bp, secondary structures ΔG >-3 kcal/mol
  • Multiplex compatibility: Sequences avoid cross-hybridization (analyzed with Primer Analyzer)

Pre-Order Oligo Pool QC

Sequence Pool Input(FASTA format, up to 10K)Batch Sequence QC ToolValidate 7 QC parametersGC Content40-60%SD <2%Pool meanTm Analysis55-70°CRange <10°CUniformityHomopolymersDetect runs>4bp flaggedNo Critical fail2° StructuresΔG threshold>-3 kcal/molPassPass Rate>95%?PASSExport PoolSynthesis-readyFAILFlagged SequencesRequires actionRedesign & Re-QCTarget Metrics:95-98% pass rate | GC SD <2% | Tm range <8°C | CV <12% | 2-3 QC iterations typical

Workflow Overview: Input sequences → Batch validation → Pass/Fail decision → Export or redesign → Iterate until >95% pass rate

Industry-Standard QC Metrics

1. GC Content Analysis (use GC Content Analyzer)

  • Acceptable range: 40-60% (individual sequences)
  • Pool uniformity: Mean 45-55%, standard deviation <2%
  • Critical flags: <30% or >70% (synthesis failure risk >50%)
  • NGS libraries: Maintain ±2% GC for uniform PCR amplification

2. Melting Temperature Validation (use Tm Calculator)

  • Calculation method: Nearest-neighbor thermodynamics (SantaLucia & Hicks 2004, Annu. Rev. Biophys. Biomol. Struct. - most accurate unified parameters)
  • PCR primers: 55-65°C (±3°C within pool)
  • qPCR/hybridization: 60-70°C (±2°C for multiplex)
  • Pool uniformity: <10°C range, <3°C SD optimal
  • Salt conditions: Validate at experimental [Na+] (typically 50mM), use Owczarzy 2008 salt correction for accuracy

3. Homopolymer Detection

  • Critical threshold: No runs >4bp (synthesis error rate increases 5-10x)
  • Poly-A/T runs: Flag >3bp (array synthesis slippage)
  • Poly-G runs: Flag >3bp (secondary structure formation)
  • Cost impact: Homopolymer failures waste $200-500 per 96-well plate

4. Secondary Structure Analysis (use Secondary Structure Predictor)

  • Hairpin threshold: ΔG >-3 kcal/mol (stable structures inhibit synthesis)
  • Self-dimer threshold: ΔG >-5 kcal/mol (critical for PCR)
  • Stem-loop structures: Flag stems >4bp with loops <3nt
  • Analysis conditions: Validate at synthesis temperature (37°C) and experimental temperature

5. Sequence Complexity & Composition

  • Low complexity: Flag dinucleotide repeats (AT/TA, GC/CG) >6bp
  • Base balance: Each base 15-40% of total sequence
  • 3' end stability: Last 5bp should have balanced GC (40-60%)
  • Forbidden motifs: Check for restriction sites, adapter sequences

6. Pool Uniformity Metrics (use Pool Uniformity Estimator)

Bioinformatics researcher analyzing GC content and Tm uniformity bell curves
  • Gini Coefficient: Target <0.15 for high uniformity in array synthesis. A Gini coefficient >0.25 indicates heavy pooling bias.
  • Coefficient of variation (CV): <15% for GC content, Tm, length
  • Outlier threshold: Flag sequences >2 SD from mean
  • Synthesis yield prediction: Uniform pools: 80-95% yield; non-uniform: 30-60%
  • NGS coverage uniformity: CV <20% ensures <3-fold representation bias

Quick Reference: Application-Specific QC Thresholds

Based on industry standards and vendor specifications (2026)

ParameterPCR PrimersqPCR ProbesCRISPR sgRNANGS AdaptersOligo Pools
GC Content40-60%
Optimal: 50%
40-60%
Strict ±5%
40-60%
Optimal: 50-55%
45-55%
Balanced required
45-55% mean
SD <2%
Tm Range55-65°C
Pool: ±3°C
60-70°C
Pool: ±2°C
N/A
Not critical
Matched
Pool: ±2°C
Application-dep.
Range <10°C
Length18-25 bp
20-22 bp ideal
18-30 bp
Probe-specific
19-21 bp
20 bp standard
18-25 bp
Fixed per design
40-200 bp
CV <10%
Homopolymers<4 bp
No poly-G >3
<4 bp
Strict
<4 bp
No poly-T >4
<4 bp
Critical
<4 bp
Array: <4 strict
Secondary StructuresΔG >-3 kcal/mol
Hairpins critical
ΔG >-2 kcal/mol
Very strict
ΔG >-3 kcal/mol
Check carefully
ΔG >-4 kcal/mol
Moderate
ΔG >-3 kcal/mol
Pool average
3' StabilityGC clamp (2-3bp)
Required
No G at 5' end
Quenching
Balanced
Not critical
Balanced
GC 40-60%
Variable
Application-dep.
Critical QC FocusTm uniformity, dimersStructures, Tm precisionPoly-T, off-targetsEdit distance, balanceUniformity, outliers

Note: Thresholds based on Illumina (2023), IDT (2026), Twist Bioscience (2026) technical specifications, and ISO 20395:2019 recommendations. Use Batch Sequence QC to validate against these thresholds.

2. How Do You Run Batch Sequence QC on a Large Sequence Set?

Step 1: Prepare Your Sequences

Format sequences in FASTA format. Each sequence should have a header line starting with">" followed by an identifier, and one or more lines containing the nucleotide sequence.

Example FASTA format:
>sequence_001
ATCGATCGATCGATCGATCG
>sequence_002
GCTAGCTAGCTAGCTAGCTA
>sequence_003
ATATATATATATATATATAT

Ensure sequences contain only valid nucleotides (A, T, C, G for DNA; A, U, C, G for RNA). Remove any formatting characters, spaces, or ambiguous bases before QC.

Step 2: Access Batch QC Tool

Navigate to the Batch Sequence QC tool. This tool is specifically designed for comprehensive quality control of large sequence sets.

Step 3: Input Sequences

You can input sequences in two ways:

  • Paste sequences: Copy and paste FASTA-formatted sequences directly
  • Upload file: Click"Upload File" and select a .txt or .fasta file

The tool supports up to 10,000 sequences per batch. For larger pools, split into multiple batches.

Step 4: Configure QC Thresholds

Set appropriate thresholds for your application:

Standard Thresholds (Most Applications):

  • GC Content: 40-60% (flag <30% or >70%)
  • Melting Temperature: 55-65°C (flag outside range)
  • Length: 18-30 bp (flag outside range)
  • Homopolymers: Flag runs of 4+ identical bases
  • Secondary Structures: Flag hairpins (ΔG < -3 kcal/mol) and dimers (ΔG < -5 kcal/mol)

Application-Specific Adjustments:

  • qPCR: Tighter Tm range (60-65°C), stricter secondary structure requirements
  • CRISPR: Length 19-21 bp, check secondary structures carefully
  • Oligo pools: Focus on uniformity, flag outliers

Step 5: Run QC Analysis

Click"Run QC" to start analysis. The tool will:

  • Validate sequence format and composition
  • Calculate GC content for each sequence
  • Calculate melting temperatures
  • Check for homopolymers and repeats
  • Predict secondary structures
  • Flag sequences that fail any threshold
  • Generate summary statistics

Processing time depends on pool size. Most batches process in 30-120 seconds.

Step 6: Review Results

Dark mode bioinformatics dashboard showing 10,000 sequences passing batch QC

The results panel displays:

Summary Statistics:

  • Total sequences analyzed
  • Number of sequences passing all thresholds
  • Number of sequences flagged (and reasons)
  • GC content distribution (mean, median, range)
  • Tm distribution (mean, median, range)

Flagged Sequences:

  • List of sequences that failed thresholds
  • Specific reasons for each flag (GC, Tm, homopolymer, structure, etc.)
  • Severity indicators (warning vs. critical)

Pool Uniformity Metrics:

  • GC content standard deviation (lower is better)
  • Tm range (smaller is better for uniformity)
  • Distribution histograms

Step 7: Take Action on Flagged Sequences

For each flagged sequence, decide:

  • Accept: Minor issues may be acceptable for your application
  • Redesign: Modify sequence to meet thresholds
  • Exclude: Remove non-critical sequences

After fixing sequences, re-run QC to confirm all sequences pass thresholds.

Step 8: Export Results

Export QC results as CSV for:

  • Documentation and record-keeping
  • Further analysis in Excel or R
  • Integration with synthesis orders
  • Tracking QC history

The CSV includes all sequence information, QC results, and flags for easy filtering and analysis.

3. What Does a Real QC Iteration Look Like on a CRISPR Library?

Researcher examining a 384-well microplate with CRISPR-Cas9 molecular structure in background

Example: 1,000 Sequence CRISPR Screening Library

Initial QC Results (Iteration 1)

  • Total sequences:1,000
  • Sequences passed:847 (84.7%)
  • Sequences flagged:153 (15.3%)
  • Failure breakdown:
  • GC content issues:62 (6.2%)
  • Homopolymer runs >4bp:51 (5.1%)
  • Poly-T terminator (TTTT):28 (2.8%)
  • Secondary structures:12 (1.2%)

Pool Uniformity Metrics

  • Mean GC content:52.3%
  • GC standard deviation:4.1% (target: <2%)
  • Mean Tm:58.7°C
  • Tm range:16.2°C (target: <10°C)
  • Length (all sequences):20 bp
  • Coefficient of variation:18.3% (target: <15%)

Remediation Actions Taken

  1. GC content optimization (62 sequences): Adjusted wobble positions in coding sequences, substituted AT-rich regions with GC bases where functionally acceptable. 58 sequences corrected, 4 excluded.
  2. Homopolymer disruption (51 sequences): Broke poly-A/T runs by inserting G/C at position +2 or +3 of runs. All 51 sequences successfully redesigned.
  3. Poly-T terminator removal (28 sequences): Critical for CRISPR - replaced T bases to avoid transcription termination. 27 sequences corrected, 1 target excluded (no viable alternative).
  4. Secondary structure disruption (12 sequences): Modified stem sequences to break complementarity, validated with Structure Predictor. All 12 corrected.

Final QC Results (Iteration 2)

  • Total sequences:995 (5 excluded)
  • Sequences passed:967 (97.2%)
  • Sequences flagged:28 (2.8%)
  • Target >95% achieved

Improved Uniformity

  • GC standard deviation:1.8% (within target)
  • Tm range:8.3°C (within target)
  • Coefficient of variation:11.2% (within target)
  • All metrics within target

Outcome: Pool synthesized by Twist Bioscience (array synthesis). Post-synthesis NGS validation showed 98.1% of sequences present with median coverage CV of 17.2% (within acceptable range). Only 1.9% sequence dropout, significantly better than 5-10% typical for non-QC'd pools. Total QC time: 4.5 hours across 2 iterations. Estimated cost savings: $1,800 (avoided failed synthesis and 3-week re-synthesis delay).

4. Which QC Habits Reduce Synthesis Failures and Rework?

1. Implement Iterative QC During Design

Run QC at design stage (not pre-synthesis only) to enable rapid iteration. For pools >1,000 sequences, QC in batches of 500-1,000 during generation. Early QC reduces redesign time from days to hours and identifies systematic design flaws (e.g., biased GC distribution, repetitive motifs).

  • Design checkpoint QC: 25%, 50%, 75%, 100% completion
  • Real-time validation: Use Batch QC API integration for automated validation
  • Cost-benefit: 2 hours QC iteration saves $500-2,000 in failed synthesis and 2-4 weeks project delay

2. Application-Specific Threshold Optimization

Start with platform-validated defaults, then optimize based on pilot data. Array synthesis (Agilent, Twist) requires stricter thresholds than column synthesis (IDT). NGS applications need tighter uniformity (GC SD <2%, Tm range <8°C) than PCR pools.

  • Pilot synthesis: Test 96 sequences across parameter space before full pool
  • Threshold refinement: Analyze synthesis yield vs. QC stringency to optimize cost/quality trade-off
  • Platform consultation: Vendors provide application-specific QC guidelines (request from synthesis provider)

3. Prioritize Pool Uniformity Over Individual Perfection

For pools >100 sequences, uniformity metrics (CV, SD, range) predict experimental success better than individual sequence quality. Target: GC SD <2%, Tm range <10°C, length CV <10%. Exclude outliers >2 SD from mean even if individually"passing" to improve pool uniformity.

  • Uniformity validation: Use Pool Uniformity Estimator for synthesis yield prediction
  • Statistical QC: Calculate and track CV, SD, interquartile range for each parameter
  • Outlier management: Remove sequences >2 SD from mean or modify to bring within 1.5 SD

4. Comprehensive Documentation for Reproducibility

Maintain QC documentation for troubleshooting, regulatory compliance (diagnostics/therapeutics), and method validation. Essential records: original sequences, QC parameters/thresholds, flagged sequences, modifications, re-QC results, final sequences, synthesis order details.

  • Export formats: CSV from Batch QC, synthesis formats from Format Converter
  • Version control: Track QC iterations (v1, v2, v3) with timestamps and modification rationale
  • Regulatory compliance: ISO 20395:2019 (oligonucleotide QC standard), ISO 13485 (medical devices), FDA 21 CFR Part 11 (electronic records), CLIA/CAP (clinical diagnostics)

5. Integrated Multi-Tool QC Workflow

Comprehensive QC requires multiple specialized tools. Recommended workflow:

  1. Batch Sequence QC - primary validation (all parameters)
  2. GC Content Analyzer - distribution analysis and outlier detection
  3. Tm Calculator - thermodynamic validation with experimental salt conditions
  4. Secondary Structure Predictor - detailed structure analysis for flagged sequences
  5. Pool Uniformity Estimator - synthesis yield and coverage prediction
  6. Error Rate Calculator - synthesis quality metrics and cost estimation
  7. Format Converter - export to vendor-specific synthesis formats

See the full page on how to QC a large oligo pool before ordering with benchmarking data and troubleshooting guides.

QC Success Metrics

  • Target pass rate: 95-98% after QC iteration (industry standard)
  • Pool uniformity: GC SD <2%, Tm range <8°C, CV <12%
  • Synthesis yield: >80% sequences with >50% expected yield
  • NGS coverage: Median CV <20%, no sequences <10% median coverage
  • Experimental success: <5% PCR failure rate, <10% NGS dropout

Frequently Asked Questions

What is oligo pool QC and why is it important?

Oligo pool QC validates oligonucleotide sequences before synthesis to prevent platform-specific failures and ensure experimental reproducibility. Critical for array-based synthesis (Agilent, Twist Bioscience, GenScript), column synthesis (Integrated DNA Technologies/IDT, Merck/MilliporeSigma, Eurofins Genomics), and enzymatic synthesis (Molecular Assemblies, DNA Script) platforms.

  • Prevents synthesis failures (15-30% unchecked pools): Homopolymers >4bp cause coupling errors; GC extremes (<30%, >70%) reduce yield 50-80%
  • Ensures NGS library uniformity: GC bias creates 3-10x coverage variation; Tm variation (>10°C) causes differential PCR amplification
  • Reduces experimental failures: Secondary structures (ΔG <-3 kcal/mol) inhibit PCR (50% failure rate); self-dimers prevent primer extension
  • Cost savings: Pre-synthesis QC saves $200-500 per failed 96-well plate; re-synthesis delays projects 2-4 weeks
  • Regulatory compliance: ISO 20395:2019 defines oligonucleotide QC requirements; FDA 21 CFR Part 820, EU MDR 2017/745 mandate documented validation for diagnostic/therapeutic oligos

For pools >100 sequences, systematic QC using Batch Sequence QC is essential to identify problematic sequences before synthesis. See our full page on how to QC a large oligo pool before ordering.

What parameters should I check during QC?

Comprehensive QC validates 7 critical parameters with application-specific thresholds:

  • GC content (use GC Analyzer): 40-60% individual, 45-55% pool mean, <2% SD for NGS libraries. Extreme GC (<30%, >70%) reduces synthesis yield 50-80%
  • Melting temperature (use Tm Calculator): Nearest-neighbor method (SantaLucia 1998). PCR: 55-65°C, qPCR: 60-70°C. Pool uniformity: <10°C range, <3°C SD optimal
  • Sequence length: PCR primers 18-25bp, qPCR probes 18-30bp, CRISPR guides 19-21bp. Validate with Properties Calculator
  • Homopolymers: Critical: no runs >4bp (5-10x synthesis error rate). Flag poly-A/T, poly-G >3bp
  • Secondary structures (use Structure Predictor): Hairpin ΔG >-3 kcal/mol, self-dimer ΔG >-5 kcal/mol. Validate at 37°C (synthesis) and experimental temperature
  • Sequence complexity: Flag dinucleotide repeats >6bp, low entropy sequences. Each base should be 15-40% of total
  • Cross-reactivity (use Primer Analyzer): Check heterodimer formation in multiplex assays, avoid adapter/primer homology

Batch Sequence QC validates all parameters simultaneously with customizable thresholds. Export results for integration with synthesis order formats.

How do I set appropriate QC thresholds?

QC thresholds depend on application and synthesis platform. Evidence-based recommendations:

  • PCR primers (analyze with Primer Analyzer): GC 40-60%, Tm 55-65°C (±3°C pool), length 18-25bp, homopolymers <4bp, hairpin ΔG >-2 kcal/mol, 3' end GC clamp (2-3 bases)
  • qPCR probes/primers: GC 40-60%, Tm 60-70°C (probe 5-10°C > primers), length 18-30bp, strict secondary structure requirements (hairpin ΔG >-2 kcal/mol), no G at 5' end (quenching)
  • CRISPR sgRNA (use GC Analyzer): GC 40-60% (optimal 50-55%), length 19-21bp (20bp standard), avoid poly-T (>4bp = transcription terminator), check off-target similarity
  • NGS library adapters/indexes: GC 45-55%, Tm ±2°C (critical for multiplexing), balanced base composition (no >60% single base), edit distance >3bp between indexes
  • Hybridization capture probes (120mer): GC 45-55%, Tm 65-75°C (±5°C pool), avoid repetitive elements (>15bp repeats), uniqueness score >0.9
  • Array synthesis pools (Agilent, Twist): Uniform GC (45-55% mean, <2% SD), Tm <10°C range, homopolymers <4bp, length variation <10%, no secondary structures ΔG <-4 kcal/mol

Synthesis platform considerations:

  • Array synthesis (Agilent SurePrint, Twist Bioscience): Photolithography method. Strict homopolymer limits (<4bp), GC 40-60%, excellent for high-density pools (10K-1M sequences), length typically 40-200bp, cost-effective for large pools
  • Column synthesis (IDT, Merck/MilliporeSigma, Eurofins): Phosphoramidite chemistry. More tolerant to GC extremes (30-70%), homopolymers <6bp acceptable, higher fidelity individual oligos, length up to 300bp+, premium quality for critical applications
  • Enzymatic synthesis (Molecular Assemblies, DNA Script): Template-free enzymatic method (2026-2026 commercial availability). No homopolymer limitations, excellent for modified bases, length up to 200bp, slower throughput but emerging technology

Batch QC tool provides validated default thresholds with customization for specific applications. Test thresholds with pilot synthesis (96 oligos) before scaling to full pools. See Tm calculation tutorial for thermodynamic validation.

How many sequences can I QC at once?

Our Batch Sequence QC tool can process up to 10,000 sequences per batch. For larger pools:

  • Split into batches: Process 10,000 sequences at a time
  • Sample first: QC a representative subset to identify common issues
  • Pre-filter: Remove obviously problematic sequences before QC

Processing time depends on:

  • Number of sequences
  • Average sequence length
  • Number of QC parameters checked
  • Server load

Most batches of 1,000-5,000 sequences process in 30-60 seconds. Very large batches (10,000 sequences) may take 1-2 minutes.

What should I do with flagged sequences?

Flagged sequences require systematic remediation before synthesis. Decision tree approach:

  • Severity assessment: Critical flags (homopolymers >5bp, extreme GC <30% or >70%, strong secondary structures ΔG <-5 kcal/mol) require immediate action. Warning flags (GC 30-40%, Tm outliers) may be acceptable for non-critical applications
  • Failure mode analysis: Homopolymer flags predict 60% synthesis failure; secondary structure flags predict 50% PCR failure. Prioritize by experimental impact
  • Redesign strategies: Use synonymous codon substitution (protein-coding), silent mutations (non-coding), or position shift (if sequence location flexible)
  • Exclusion criteria: Sequences failing >2 critical parameters or requiring >5 base changes often better excluded than redesigned
  • Documentation (export from Batch QC): CSV with original sequence, flags, modifications, re-QC results. Required for regulatory compliance and troubleshooting

Remediation strategies by flag type:

  • GC content: For low GC (<40%), substitute A/T with G/C at wobble positions or silent sites. For high GC (>60%), reverse strategy. Validate with GC Analyzer
  • Tm uniformity: Adjust length (±2-3bp) or modify GC-rich regions. For pools, prioritize uniformity over individual Tm targets. Calculate with Tm Calculator
  • Homopolymers: Break poly-A/T runs with G/C substitutions at position +2 or +3 from run start. Break poly-G/C with A/T. Verify no new secondary structures created
  • Secondary structures (check with Structure Predictor): Disrupt hairpin stems by substituting complementary bases (e.g., G-C pair to G-T). For self-dimers, modify 3' end (last 5bp) to reduce complementarity
  • Low complexity: Introduce base diversity while maintaining function. For dinucleotide repeats, alternate with other bases every 4-6bp

Iterative QC workflow:

  1. Initial QC with Batch Sequence QC
  2. Categorize flags by severity (critical vs. warning)
  3. Redesign critical failures using strategies above
  4. Re-run QC on modified sequences
  5. Iterate until 95%+ pass rate (industry standard for pool quality)
  6. Export final sequences in synthesis format

For pools >1,000 sequences, expect 10-20% initial failure rate. Systematic redesign typically achieves 95-98% pass rate after 2-3 QC iterations. Sequences failing after 3 redesign attempts should be excluded or synthesized separately with verification sequencing.

How do I ensure pool uniformity?

Pool uniformity determines synthesis yield and experimental reproducibility. Quantitative validation metrics:

  • GC content uniformity (analyze with GC Analyzer): Mean 45-55%, standard deviation <2% (NGS libraries), <5% (PCR pools). Coefficient of variation (CV) <10% optimal. GC SD >5% causes 3-10x coverage bias in NGS
  • Melting temperature uniformity (batch Tm Calculator): Range <10°C (acceptable), <5°C (optimal), SD <3°C. Tm range >15°C causes differential amplification in PCR (up to 100-fold bias)
  • Length uniformity: For fixed-length pools: ±0bp (strict). For variable-length: CV <10%, no sequences >2 SD from mean. Length variation >20% affects hybridization kinetics
  • Compositional balance: Each base 20-30% of total pool nucleotides (deviation <5% optimal). Extreme base bias (>40% single base) causes synthesis coupling inefficiencies
  • Synthesis yield prediction (use Uniformity Estimator): Uniform pools (CV <15%): 80-95% representation. Non-uniform pools (CV >25%): 30-60% representation with 10-fold abundance variation

Experimental validation approaches:

  • NGS coverage analysis: Sequence pilot pool (10,000-100,000 reads). Ideal: median coverage CV <20%, no sequences <10% median coverage
  • qPCR uniformity test: Sample 20-50 sequences, measure Cq variation. Acceptable: ΔCq <2 cycles, indicating <4-fold abundance variation
  • Synthesis QC metrics: Array synthesis uniformity score >0.8 (vendor-provided). Column synthesis: >95% sequences with >50% expected yield

Integrated QC workflow for uniformity:

  1. Batch Sequence QC - comprehensive validation
  2. GC Content Analyzer - distribution analysis
  3. Tm Calculator - thermodynamic uniformity
  4. Pool Uniformity Estimator - synthesis yield prediction
  5. Error Rate Calculator - quality metrics

Target metrics for high-quality pools: GC SD <2%, Tm range <8°C, CV <12%, >95% sequences pass QC. See complete pool QC workflow with case studies and troubleshooting guidance.

Next Pages to Open

Open Batch Sequence QC

Process up to 10,000 sequences in <2 minutes. Industry-standard QC thresholds with customizable parameters. Reduce synthesis failures from 15-30% to <5%. Export results in synthesis-ready formats. Free, no registration required.