Tm Calculator Accuracy: OligoPool.com vs NEB, IDT & Thermo Fisher

OligoPool calculators use published, peer-reviewed algorithms for Tm, salt correction, secondary-structure interpretation, molecular weight, and GC content. This page documents the formulas, reference papers, and comparison conditions used to review results against NEB, IDT, and Thermo Fisher-style tools.

±0.5°C

Typical Tm agreement with NEB
under matched conditions

Client-side

Sequences are processed
in the browser

Published

Thermodynamic parameters
come from literature

1. Algorithm Transparency

Every calculation on OligoPool.com uses published algorithms. There are no proprietary "secret sauce" formulas — the same thermodynamic parameters available in peer-reviewed literature power all major tools, including ours.

CalculatorCore AlgorithmReferenceAlso Used By
Tm CalculatorNearest-neighbor (NN) thermodynamicsSantaLucia, PNAS 1998NEB, IDT, Thermo Fisher, Primer3
Salt CorrectionUnified Na⁺/Mg²⁺ correctionOwczarzy et al., Biochemistry 2008NEB, Primer3, most modern tools
Secondary Structure ΔGNN stacking + loop parametersSantaLucia 1998, Zuker 2003IDT OligoAnalyzer, UNAfold, mfold
Molecular WeightSum of nucleotide MWs − (n-1) × H₂OIUPAC atomic weights 2021All tools (deterministic formula)
GC Content(G+C) / total bases × 100Standard definitionAll tools (exact same result)
Method note: Tm calculator accuracy depends on the algorithm, thermodynamic parameters, and concentration settings. NEB, IDT, and OligoPool-style calculations draw from published nearest-neighbor parameters. The ΔH° and ΔS° values for each of the 10 unique dinucleotide steps (AA/TT, AT/TA, etc.) come from the SantaLucia 1998 paper.

2. Method Comparison: Tm Results

We validated our Tm Calculator against NEB and IDT using representative primer sequences spanning different lengths, GC content, and compositions. Conditions: 50 mM Na⁺, 0 mM Mg²⁺, 250 nM oligo.

Sequence (5'→3')LengthGC%OligoPoolNEBΔ
ATCGATCGATCGATCGATCG2050%56.4°C56.4°C0.0°C
GCGCGCGCATATATATAT1844%49.5°C49.7°C-0.2°C
GCCGCCGCCGCCGCCGCCGCC21100%78.1°C78.3°C-0.2°C
AATTAATTAATTAATTAATT190%34.6°C34.8°C-0.2°C
TCAGCTGAACGGTCAGTCAG2055%58.9°C59.1°C-0.2°C
Methodology: All Tm values calculated using nearest-neighbor method with SantaLucia 1998 unified parameters. Salt correction: Owczarzy 2008. Differences of ±0.2-0.5°C are normal between implementations and arise from rounding, initiation parameter handling, and dangling end treatment — not from algorithmic differences. These variations are well within the ±1-2°C experimental accuracy of Tm measurement.

3. Why Small Differences Exist Between Tools

Even when two calculators use the same algorithm, results can differ by ±0.5°C. Here is why — and why it does not matter:

Source of DifferenceTypical ImpactExplanation
Rounding precision±0.1°CDifferent tools round intermediate ΔH/ΔS values at different points
Initiation parameters±0.2°CSantaLucia 1998 defines different initiation ΔH/ΔS for A/T vs G/C terminal pairs — implementation varies
Salt correction version±0.3°COwczarzy 2004 vs 2008 formula; 2008 improves Mg²⁺ handling
Self-complementarity±0.5°CWhether the tool applies the self-complementary correction factor
Oligo concentration±0.3°CDefault 0.25 µM (OligoPool, NEB) vs 0.5 µM (some tools)
Interpretation: Experimental Tm measurement has ±1-2°C reproducibility. Inter-calculator differences of ±0.5°C are usually within measurement noise. If NEB and OligoPool results differ by more than 2°C, check salt concentration and oligo concentration settings first.

4. Feature Comparison

Same core algorithm, different feature sets. Here is where OligoPool.com differentiates:

FeatureOligoPool.comNEB Tm CalculatorIDT OligoAnalyzer
Tm AlgorithmSantaLucia 1998SantaLucia 1998SantaLucia 1998
Salt CorrectionOwczarzy 2008Owczarzy 2008Owczarzy 2004
Batch Tm CalculationUp to 1,000 sequencesSingle sequenceSingle sequence
Secondary StructureHairpins and dimersNot providedDetailed
Pool/Library QCFull suiteNot providedLimited
Vendor Format ExportIDT, Twist, GenScriptNot providedIDT only
Account RequiredNoNoFree account
Data PrivacyBrowser by default; opt-in Library/API savesServer-sideServer-side
PriceFreeFreeFree (with account)

5. Reproduce the Comparison

Use the same sequence and reaction settings in both calculators before comparing Tm values:

1

Enter a test sequence

Use ATCGATCGATCGATCGATCG (20-mer, 50% GC) in our Tm Calculator.

2

Set standard conditions

50 mM Na⁺, 0 mM Mg²⁺, 250 nM oligo concentration.

3

Compare with NEB

Enter the same sequence at tmcalculator.neb.com with matching conditions. Expected: ≤0.5°C difference.

Expected result: Both tools should return approximately 56.4°C for this sequence. A difference within 0.5°C is consistent with matched nearest-neighbor settings. Larger differences usually indicate mismatched salt, magnesium, or oligo concentration values.

6. Scientific References

Nearest-Neighbor Thermodynamics (Tm)

SantaLucia J Jr. "A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics." Proc Natl Acad Sci USA. 1998;95(4):1460-1465. doi:10.1073/pnas.95.4.1460

Salt Correction Formula

Owczarzy R, et al. "Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations." Biochemistry. 2008;47(19):5336-5353. doi:10.1021/bi702363u

Secondary Structure Prediction

Zuker M. "Mfold web server for nucleic acid folding and hybridization prediction." Nucleic Acids Res. 2003;31(13):3406-3415. doi:10.1093/nar/gkg595

Use the Referenced Calculators

Run the same sequence through the relevant calculator after checking the method assumptions and reaction settings.