Tm Calculator Accuracy: OligoPool.com vs NEB, IDT & Thermo Fisher
OligoPool calculators use published, peer-reviewed algorithms for Tm, salt correction, secondary-structure interpretation, molecular weight, and GC content. This page documents the formulas, reference papers, and comparison conditions used to review results against NEB, IDT, and Thermo Fisher-style tools.
±0.5°C
Typical Tm agreement with NEB
under matched conditions
Client-side
Sequences are processed
in the browser
Published
Thermodynamic parameters
come from literature
1. Algorithm Transparency
Every calculation on OligoPool.com uses published algorithms. There are no proprietary "secret sauce" formulas — the same thermodynamic parameters available in peer-reviewed literature power all major tools, including ours.
| Calculator | Core Algorithm | Reference | Also Used By |
|---|---|---|---|
| Tm Calculator | Nearest-neighbor (NN) thermodynamics | SantaLucia, PNAS 1998 | NEB, IDT, Thermo Fisher, Primer3 |
| Salt Correction | Unified Na⁺/Mg²⁺ correction | Owczarzy et al., Biochemistry 2008 | NEB, Primer3, most modern tools |
| Secondary Structure ΔG | NN stacking + loop parameters | SantaLucia 1998, Zuker 2003 | IDT OligoAnalyzer, UNAfold, mfold |
| Molecular Weight | Sum of nucleotide MWs − (n-1) × H₂O | IUPAC atomic weights 2021 | All tools (deterministic formula) |
| GC Content | (G+C) / total bases × 100 | Standard definition | All tools (exact same result) |
2. Method Comparison: Tm Results
We validated our Tm Calculator against NEB and IDT using representative primer sequences spanning different lengths, GC content, and compositions. Conditions: 50 mM Na⁺, 0 mM Mg²⁺, 250 nM oligo.
| Sequence (5'→3') | Length | GC% | OligoPool | NEB | Δ |
|---|---|---|---|---|---|
| ATCGATCGATCGATCGATCG | 20 | 50% | 56.4°C | 56.4°C | 0.0°C |
| GCGCGCGCATATATATAT | 18 | 44% | 49.5°C | 49.7°C | -0.2°C |
| GCCGCCGCCGCCGCCGCCGCC | 21 | 100% | 78.1°C | 78.3°C | -0.2°C |
| AATTAATTAATTAATTAATT | 19 | 0% | 34.6°C | 34.8°C | -0.2°C |
| TCAGCTGAACGGTCAGTCAG | 20 | 55% | 58.9°C | 59.1°C | -0.2°C |
3. Why Small Differences Exist Between Tools
Even when two calculators use the same algorithm, results can differ by ±0.5°C. Here is why — and why it does not matter:
| Source of Difference | Typical Impact | Explanation |
|---|---|---|
| Rounding precision | ±0.1°C | Different tools round intermediate ΔH/ΔS values at different points |
| Initiation parameters | ±0.2°C | SantaLucia 1998 defines different initiation ΔH/ΔS for A/T vs G/C terminal pairs — implementation varies |
| Salt correction version | ±0.3°C | Owczarzy 2004 vs 2008 formula; 2008 improves Mg²⁺ handling |
| Self-complementarity | ±0.5°C | Whether the tool applies the self-complementary correction factor |
| Oligo concentration | ±0.3°C | Default 0.25 µM (OligoPool, NEB) vs 0.5 µM (some tools) |
4. Feature Comparison
Same core algorithm, different feature sets. Here is where OligoPool.com differentiates:
| Feature | OligoPool.com | NEB Tm Calculator | IDT OligoAnalyzer |
|---|---|---|---|
| Tm Algorithm | SantaLucia 1998 | SantaLucia 1998 | SantaLucia 1998 |
| Salt Correction | Owczarzy 2008 | Owczarzy 2008 | Owczarzy 2004 |
| Batch Tm Calculation | Up to 1,000 sequences | Single sequence | Single sequence |
| Secondary Structure | Hairpins and dimers | Not provided | Detailed |
| Pool/Library QC | Full suite | Not provided | Limited |
| Vendor Format Export | IDT, Twist, GenScript | Not provided | IDT only |
| Account Required | No | No | Free account |
| Data Privacy | Browser by default; opt-in Library/API saves | Server-side | Server-side |
| Price | Free | Free | Free (with account) |
5. Reproduce the Comparison
Use the same sequence and reaction settings in both calculators before comparing Tm values:
Enter a test sequence
Use ATCGATCGATCGATCGATCG (20-mer, 50% GC) in our Tm Calculator.
Set standard conditions
50 mM Na⁺, 0 mM Mg²⁺, 250 nM oligo concentration.
Compare with NEB
Enter the same sequence at tmcalculator.neb.com with matching conditions. Expected: ≤0.5°C difference.
6. Scientific References
Nearest-Neighbor Thermodynamics (Tm)
SantaLucia J Jr. "A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics." Proc Natl Acad Sci USA. 1998;95(4):1460-1465. doi:10.1073/pnas.95.4.1460
Salt Correction Formula
Owczarzy R, et al. "Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations." Biochemistry. 2008;47(19):5336-5353. doi:10.1021/bi702363u
Secondary Structure Prediction
Zuker M. "Mfold web server for nucleic acid folding and hybridization prediction." Nucleic Acids Res. 2003;31(13):3406-3415. doi:10.1093/nar/gkg595
Use the Referenced Calculators
Run the same sequence through the relevant calculator after checking the method assumptions and reaction settings.